Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:45-b10   

Cenix:45-b10RNAiCenix:45-b10
PCR_productcenix:45-b10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57G11A.5 Source_evidenceePCR366WS150 Sequence/Annotation Release
Overlaps_Gene Y57G11A.5 Source_evidenceePCR366WS150 Sequence/Annotation Release
Chunk_score Abs_score282
Max_abs_score282Y57G11A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1451174814512817
Overlaps_transcriptY57G11A.5 Source_evidenceePCR366WS150 Sequence/Annotation Release
WB_DNA_textTH:45-b101070accccgtgatcaggtcaatagaaaaattatgtttcaggtattttaccaaattttatgtttttttttcaaaaattatttatatttattgatatttatagttacattaaatattttgtctcttcaagttctccaactccattctccttctcaaatcctctttgaaatctacctcacacatctcgacttttgcttccaaatcacagatctttctgaaaatttttgagattaaaaaagtataaaaacaagcttagaagttttgaaggatatttcgaaataatatttgttcattgttcatgcatcctactgaatccaaaaagctttccaaaacagtagaaattaaaaaaaaaactcactttccattaagatatttcacagcgtcaaatgcatgaacagtccgcttaaatgtaacaaatgcgaatccaggtggcctttttgccatccaaatcgatttaatcggtcccatcacggaaaacactgcttcaatctgaaaatttattttcggtttcagaattttgttatatgctgattctcacagcatcatagatggtcaaggcatcattattcaactaaaaaaattatattaaaaattagtatatttttgatgaaaatgacaaaaaaaacccacaaacctctttctcagtagcatcaaatggcatatttccgacgtaaacctgtcgattttcaacatttctttttcgttttcgattttgtggaattacggacatgacaatgacttcatgtctggctattttttggaaaacgaatcgaaaaatccatatgtgcaaacattagctcactgtttcatgtacagcatttaataactcgcatcatgatgagggtacttggttgtcagagctattgctttttttttgtttttggtggtttttttgggaaatatggattttttggttttttgggactaaaaaaccaaaaaataaattacaacactgtttcagcaaaacattaaaaaaaccttctgttcgttcaattccaatatttttcgaaaaaattgcatattgcaaaaattgcaaaattgcgaaaaaattgtctatgccgagacgcaaattaac