Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:46-e11   

Cenix:46-e11RNAiCenix:46-e11
PCR_productcenix:46-e11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R08C7.3 Source_evidenceePCR628WS150 Sequence/Annotation Release
Chunk_score Abs_score565
Max_abs_score565R08C7.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV44462174446894
Overlaps_transcript R08C7.3.1 Source_evidenceePCR628WS150 Sequence/Annotation Release
R08C7.3.2 Source_evidenceePCR628WS150 Sequence/Annotation Release
R08C7.3.3 Source_evidenceePCR435WS150 Sequence/Annotation Release
WB_DNA_textTH:46-e11678atctagttcgcaatggctggaggaaaaggaaaggccggaaaggactccggaaagtccaaatcgaaggtcgtatcgagaagtgctcgcgctggactccaattccctgtcggacgtatccatcgtttcttgaagcagagaaccacttccagcggacgtgtcggagctactgccgcagtatacaggtactgattccatattcttgataataaaattctaaaatttgttttttcagcgctgccatcctcgaatatctcaccgccgaagtcctcgagttggccggtaacgcctccaaggatcttaaggtgaagcgtatcaccccaagacatcttcatcttgctatcagaggagacgaagagctcgacactctcatcaaggccaccatcgccggaggaggagtcatcccacacatccatcgttatttgatgaacaagaagggagccccagtcccaggaaagccaggagctccaggacaaggaccacaataaatgctggacatacctcaaatatctaaataatctaatatttttctcaatttcaccaaaaattaatctctcatctatcactccccaataggcgacgaattaatttgatcactgcctcatccaatattcttttgtttcattcctccattcactttttaaattaaattttgtaaagccagatactcggccgctactc