Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:46-e4   

Cenix:46-e4RNAiCenix:46-e4
PCR_productcenix:46-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY116A8C.32 Source_evidenceePCR636WS150 Sequence/Annotation Release
Overlaps_Gene Y116A8C.32 Source_evidenceePCR636WS150 Sequence/Annotation Release
Chunk_score Abs_score594
Max_abs_score594Y116A8C.32
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1710468817106120
Overlaps_transcriptY116A8C.32 Source_evidenceePCR636WS150 Sequence/Annotation Release
WB_DNA_textTH:46-e41433gctcctgggcttgtgtagaaatcactgtagtcttgttgttgctgctgctgctgctgctgttggtgaccgtaagctgatcctcctggaggtgcaggtgcaccataaggttgttgatattgattaggataggcgtattgttgatagtgatctggaaaaaaacggatttttttttgaaaagaaatcacttgacctgccagaaatttgcagcaaaaagttcaaaattggcctaaaaatcgctaattttacattttttaaaggctcaaaaattgccaaaaaaaagcacaaaatttgagcattttttcgaactttaaaagccatttttgcaaattctgagcatttttaggcgattttgagctcgttttggccatttttgaacactttttagccatttttaaccactttttggaaccctttgagcattttttggtccactttcgaatttttatcgcaaaattccagcttcgtctgattttttggtccaaaatagcattttttaggcaacaaatcggctgatttttcgattttatttttgaaaccgaaattttttaattttttcgatccgttttgggttgtttccttcgaaaaatcaaaaattgttgattttcgttcgattaaaaaaaaaacgttgtctaaaatcgtattttaggtaaaatccggaaaatcctgtaattttcagttggtcaggatcgtctttttctgtgatttttcaaggtttttcagtcaaaattcaaatttttagggtaaaattcgcaaaatcccgatttttaagattttcagttccaaattcgactttttagcgtgatgaaaattcgttgatttttccatttttttggctccaaaacatgctattgtaccataatatccatgctgcatcgaagcattcgcctgctgttgctgctcttcttctcctttcggtggtccaaataaatcccgtggattctggaatccacgtcctcctccacgtccaccttgatatcctccacctcttccagctcctccatgagctccaccacctcgtcctccagctccaccaccaggagcttctcctcctgctccagtcattgctgaaattccaccaccagctgatgcaacatgtcctccacctcctcctccggctccagctccagcagccggagtttcacccaattcagccatcagagccgaatattcatcatccattccagcttctgatgcatacattccctttggatttttacaatcctttgaaatatgaccaaatgctccacaatttgtacattttatttgatttgtcacatttggagcatccgggcattcccatgatttgtgctcgtctgagccgcaattcgagcaacgagctccgctgaaaaatggggattttttatggggaaatggcggaaaatcgcttaaaactcgaaatttagagatttttcgtacgaaaatcggggaaatca