Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:47-d7   

Cenix:47-d7RNAiCenix:47-d7
PCR_productcenix:47-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C14C10.2 Source_evidenceePCR859WS150 Sequence/Annotation Release
C14C10.7 Source_evidenceePCR88WS150 Sequence/Annotation Release
Overlaps_Gene C14C10.2 Source_evidenceePCR859WS150 Sequence/Annotation Release
Chunk_score Abs_score733
Max_abs_score733C14C10.2
Specificity_index0.916
Rel_score1
Map_statusBest_ePCRV1259308812594787
C14C10.7 Source_evidenceePCR88WS150 Sequence/Annotation Release
Chunk_score Abs_score67
Specificity_index0.084
Rel_score0.091
Map_statusBottom50_percentile_ePCRV1259308812594787
Overlaps_transcript C14C10.7 Source_evidenceePCR88WS150 Sequence/Annotation Release
C14C10.2 Source_evidenceePCR859WS150 Sequence/Annotation Release
WB_DNA_textTH:47-d71700gtgacctactctgccctccagttttttttaaagagctcaaaaacttctactaaatattcttttgaaatacctttaacggaaacagattgatctcgaaaagtcgcaactctagataccaaaataagtgaagttatgagaactgtagtaacgccgagcatgacgacaactgaaacggtaacaagtgaacaaccacacataaatattgtccgttgtatgtcatgaccattattatttcaattgccagatctctactgaatcatcccgccctatacggtaatctgatgtatctgcgtctctcccacctatatactatattttagagatccaaattatgaaacagtaaaaaggtcgatggtcgaccggtatgagttttttattttattttttgactagttgttacaactttttatacgaatagttgcaaaatgactattgttttattcaaatgtgtatgttgcacctgaaaaactgaactaaaaattgatattataacagattcataacaaagaaaaaacataacaatttgtaaaacttattggctatctgtacaatttatcaaaatatataatttttccggtgcctttacattcaaacacttataaaaatgtcgaatctttccgtacaaaattgacttttgattgtcgctgacttctcgattggctttcactttccacatcaactcttccagattttcagtttttccagactttcctgaataaaaaattgaacaatttcacattatgcgaaacaaaccggctaacttgatgagctcatcgaaaattgaaaagaacgtcgaagttggaatttgaatgaattgatgaatttcgaggaggcggattagaggcattggctgaaaatttcaaaactcaatgttttatccattttcaggataatttaaaaaaactgcaatatttacatatttaagttttccagccaagttaataaagaacatcgcatcttcatgagatagtgtaactgagtttctctgaaaccaatactttctatggagtaaagaagttgcaaaacattaccttacagtaatctgcaatttccaggcgtggcatctcattaaatcgaatgaaaagttgaagggatctcaatgtggacggtttaatgaatttcgtttttgataataagatttcagctgaaaatataattatttttccatttagagcaagttgtacttatgccagtctcaccttgctcaaattccttagcattccaggcgtcttccaaaatgaaaaatacactcattgtcatactttttgttcgttgatccttatggactaattcatttaaccgctcaagcccagctttccatccgaatctataaactgatatttaaatttttaaggactaaaatgtatttaatcgctgtactttttcactgtaaactcaatcagaacacgagcaaaaacatctcgattagagcagaacttgtattttttgagaaattcgaaaaattgaaaagcagaatttcctgttttgtctttatttagaactcgttggattgctgcacagatttgatcgtcactaacatccacgtttcgagctaaaaacaattcccattagtttttgaaatttgaagctcaaaatcaccttgacgtcttgcggaaccaccgtactcctccatttgttgttttaaaaaaagttcagcttgttctgatctctgatgagacattgcgatactgctcatcctg