Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:49-g12   

Cenix:49-g12RNAiCenix:49-g12
PCR_productcenix:49-g12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F09F3.9 Source_evidenceePCR505WS150 Sequence/Annotation Release
Chunk_score Abs_score421
Max_abs_score421F09F3.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1387761513878261
Overlaps_transcript F09F3.9.1 Source_evidenceePCR505WS150 Sequence/Annotation Release
F09F3.9.2 Source_evidenceePCR505WS150 Sequence/Annotation Release
WB_DNA_textTH:49-g12647tgcattccatggtgtttttggattttggaaaaggaaaattaaaggaatgtggaatttctccagatggatttgtccaaatggcaattcagttggcttattacaaagcaggctttaattttaaagattattaacaaacttatcttcatttttaggatcaaggaaagttcactcaaacatatgaaccaggttcaattagattctacgcaaattcaagaacagaaactttgagaccagtaacaaaagcgtcttgtgaatttgttgaagccatgctctcggataaatctgatgtacgtatacaaaaatatgttcaattcgataaaattttgattttcagatagcctcccgcaggaagttattgaaagaagcttgtgaagttcatgtgaataactgtaaagaaatcatgctaggaaatggatttgatcgtcatctatttgtactatgtgttcttgcaaaaggacttggatacgaaagtccattcctcaatttcttccaaagtcagaagtggcttctgagtaccagtaatgtatgttttccgaattatttttcgcaaatatgtagatatttttccagattcccaatatgacaaactcgattgatgaagattcttcaattgacaagataatgcttggtggttcatttggagctgt