Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-a5   

Cenix:50-a5RNAiCenix:50-a5
PCR_productcenix:50-a5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26D2.15 Source_evidenceePCR542WS150 Sequence/Annotation Release
Overlaps_Gene F26D2.15 Source_evidenceePCR542WS150 Sequence/Annotation Release
Chunk_score Abs_score479
Max_abs_score479F26D2.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1644072416441352
Overlaps_transcriptF26D2.15 Source_evidenceePCR542WS150 Sequence/Annotation Release
WB_DNA_textTH:50-a5629ggaaacccgacacgaaataaaaaaatctggaatcccggcagaaaatattcttgcgattgtagccgacgtgatcacagatgaaggacagatgaggcttatcaacgatactgttcgaaaatttggtcaccttgacattttggtgaacaatgccggaggagcattgatggatgctcaggggcgtgttggaatggatcaggatatttcggtgttcgataacactatgcagatcaatatgagaagtgtggttactttggtgcaaaaggccaaggagcatttgatcaaatcaaagggagaaatcattaatgtttctgccatggcagcaggacaccatggggtaagtttacgctggaactaaactttaattcaactttccacaggaccccatagcaactttctacggaatgtccaaggcagctcttgatcagttcactagaagctctgcgatttctctgatccaacacggagtccgcgtgaactccgtcagtcctggatttactaagacaggattcggagaagccatgggatttccaccaatagcgatgaaaaaggtaaaccttatattgtgatctttttaaaatatttattaaaccaggtcataagcttctacgaatcccacaaggagtgtgctc