Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-c2   

Cenix:50-c2RNAiCenix:50-c2
PCR_productcenix:50-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W03C9.7 Source_evidenceePCR507WS150 Sequence/Annotation Release
Chunk_score Abs_score487
Max_abs_score487W03C9.7
Specificity_index0.54
Rel_score1
Map_statusUnique_ePCRII1196982511970601
Y75B8A.8 Chunk_score Abs_score415
Specificity_index0.46
Rel_score0.852
Overlaps_transcript (2)
WB_DNA_textTH:50-c2777cgtcatttccagtcggatttttctgatttttcgttaaaaatcttcaaattcctattcattttatagaaatagagctgccaaacccattgattttttagtgaaatttttcaaatgttctgttttctcgctattttttaattgaaaaaatcaaaatttgagtcattttcagcgcagatttcctaatttttcccgaaaaatattcaaaatctagtagatttccataggaatttttaatttttaattaaaaaaaaattcttgcagggtcttccactgagcgagtacaaccgtgctcttcaagaaggcgagatctcaccggctcgcgacgacgagatcaccaatcccgacgaatcatcatcccaagtggaggatctgagtgagcttcaccatcgacaacatcagcagcagcagcagtaccaacaacgctatcgtcggccaccattcaacaatttccacgatatgtcggatagtggatacagtgctcctcgccgccggcttcatcatcaattcgagcatcttggtagtgagcagcagcagcagcagcagcagcagacaccagctccgaagattgtctatccatcgatgcaagttgtcaatattgaaatggcaactggtgacggacctaaaaggtctgacaatcatcattatcatcatcatcatcatcaacgtcgtcatattccggcaccaccatccaccggtccactgagctctctcattgatcaggccgactatgaagcttctatggcaagcgggaaaatgttcggaaaaccagttagtccg