Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-c8   

Cenix:50-c8RNAiCenix:50-c8
PCR_productcenix:50-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY32F6B.2 Source_evidenceePCR512WS150 Sequence/Annotation Release
Overlaps_Gene Y32F6B.2 Source_evidenceePCR512WS150 Sequence/Annotation Release
Chunk_score Abs_score470
Max_abs_score470Y32F6B.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1048992210490480
Overlaps_transcriptY32F6B.2 Source_evidenceePCR512WS150 Sequence/Annotation Release
WB_DNA_textTH:50-c8559gggatttccattggtttgtgctaactctaaatgtccgttggaaggattaattgcctccacaggggtaagatatgtcccattgtttccatttttccgtttaccattattgttattatttattacaatggtgtgatcatcgccaaagtctattggagttattactgttttgatgctatctgaatgtaccgattattttttaaaacttattctgctagacccctactttgattattaaattttgcatctggatcgtttgctggtttcaccataattgttcttccattttgtctaatttctgggactccatttgacactggttttattttattcgatctctcggacgatgatgaagatgacgatgaagaagtatcatcttcgtctccgattactaactgtgcaatgctttttctaacttcttgacctccatgaatcataggaaaactccttcgaggtccttgagcacctaaactatgaggactccttggtgtgcatccagctgcagcatctacaattgtttctggtgcaatttcacttccaatcccgactttgcgaaatagaa