Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:50-e4   

Cenix:50-e4RNAiCenix:50-e4
PCR_productcenix:50-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F11A3.2a Source_evidenceePCR506WS150 Sequence/Annotation Release
F11A3.2b Source_evidenceePCR506WS150 Sequence/Annotation Release
Overlaps_Gene F11A3.2 Source_evidenceePCR506WS150 Sequence/Annotation Release
Chunk_score Abs_score443
Max_abs_score443F11A3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV95171979517792
Overlaps_transcript F11A3.2b Source_evidenceePCR506WS150 Sequence/Annotation Release
F11A3.2a Source_evidenceePCR506WS150 Sequence/Annotation Release
WB_DNA_textTH:50-e4596cagctcacgaaaaccacagaacagcttgcagcgaaaatggaaaccttggtgattgaagatgtgaagattaatggaagtctaaagccggcgataaagaaatctactggtgttgagaaaaatgttcgacatgttcataacgttataatgccttctgtggtcacatttggtgagtttttgataatttaatttattagatttgttcttttgaagatcttccaaaaaatcaaacgaaaacgttgccgtctgcatctgattctgacgaagcagtagcatcagaaattgaatcaacagcaatcgcccaattggatgatgcgacgtcttttgtacacattcatcctgcattcttaacgcttatggctaaagcagaattggaaaaaattccagatgttgaaacagtttgtattcaatttattgctgctttcaaagaggtaaaatattatttttcaatcaaactgtataattattttattttagtttctgcgagattggacagtagaacgagaaaagaataatatcaatgcttccacattcggtcacgacctcgatttggctattcgtccacaacttgctcatatgactcaaaatggtcactggcc