Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:51-a12   

Cenix:51-a12RNAiCenix:51-a12
PCR_productcenix:51-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K05C4.1 Source_evidenceePCR626WS150 Sequence/Annotation Release
Chunk_score Abs_score584
Max_abs_score584K05C4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1471973614720412
Overlaps_transcript K05C4.1.2 Source_evidenceePCR626WS150 Sequence/Annotation Release
K05C4.1.1 Source_evidenceePCR626WS150 Sequence/Annotation Release
WB_DNA_textTH:51-a12677gtccgtcatctttggcttgtagtgattatcgaggataccgtaggcattcagagatcctgagccaactgagcacactttaagctggcaacgatctccttccgagtcgactttgaagatttgtggtcccttcttatcgtatccggccaccatcgatccaactgacaatccttgtcctctgtatccatagagcgtatttgcaaagtacttgctcgcggcgctcacggtgattgaggtcttctcgcggagctcgtacaaactgaaaataaataattatttttgttttgaagctgaaaatattgaaactcacgtgcagtacttggcgacaattcgggtccagaactgacagtcagcagctcctccagccatcgtggcaaccatacgatctccgatgtccaagatcttcatgaccgacttggatgagatgtattcaccactggaggctcgtgaatcgacagccacaatgattcctcccttgtcagctggagttgctggctcgtagacgaacgccaatgtggtggttcctttgcggaattgcatggattttccggcggtctcggcgaagtgagtcttcatgaaatcgacgggctggattcccaacggaagcttcgcgaaagtgaaatcagctcgagccggctcggcgatcaggttctgcttggccattgccatctctccttcgt