Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:51-b1   

Cenix:51-b1RNAiCenix:51-b1
PCR_productcenix:51-b1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY57G11C.13 Source_evidenceePCR558WS150 Sequence/Annotation Release
Overlaps_Gene Y57G11C.13 Source_evidenceePCR588WS150 Sequence/Annotation Release
Chunk_score Abs_score525
Max_abs_score525Y57G11C.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1479803214798815
Overlaps_transcriptY57G11C.13 Source_evidenceePCR588WS150 Sequence/Annotation Release
WB_DNA_textTH:51-b1784cggttttccgttaaacccttctgtttttctttgtgctctctcacacacacacccttttcaatcgaattgcacttttcaggaatttcctcattcaacatcaatattcaagatgttggctatggtgaataaggttctcgactggattcgcagtcttttttggaaagaggagatggagttgacacttgttgggctccaaaactctggaaaaacgacatttgtcaatgttattgctgttagtttttctggaaaataaatttaaattcaatgttcttcactttagagcggccaattcacagaagatatgatcccaacagtcggattcaatatgcggaagatcaccaaaggcaacgtgacgatcaaattatgggatatcgggggccagccacggttccgctcgatgtgggaacgatattgccgcggtgtcaacgccatcgtcttcatggtggacgctgccgacgaggagaagctcgaagcatccagaaatgagcttatgcagctgttggacaagccacagctcgacgctattccagttttggtgctcggaaacaagaaggatttgcctggagcacttgatgagcggcaattgatcgaaagaatgaatctgtcatcaatccagaatcgcgagatttgctgctattctatttcatgcaaagagaaggagaatattggtaattttttaaatctttgaaccattctaaactgaattgttttccagatatcaccctccaatggctcatcgatcactcgaaagctcaacgctaaactaggcacaatccacgactca