Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:53-b7   

Cenix:53-b7RNAiCenix:53-b7
PCR_productcenix:53-b7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F11C1.6 Source_evidenceePCR522WS150 Sequence/Annotation Release
Chunk_score Abs_score459
Max_abs_score459F11C1.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1301058113011266
Overlaps_transcript (5)
WB_DNA_textTH:53-b7686ccagagtccaacattgtccagtagcactaatcagcagcgtaagaatattttctggagttgttaatagcatcaaattataaatttcagtttctgtttccgattttatcatgagacctggatacttagttgacccacaagacagcttggcagtacttcttgggagcacaattgacgacccacttctcaggcataccttcccagcagcttatcagttgaatgaagtcaaacaggagccatttgactattcggagcagttcattcatcactcattgcacgactatccaacttataccagcaacactaccaattatgctacaatgatgccaatgacaactgtttccagcacacaatccttggtcacttcgacttcttctagtaagttttagtttttttatcgctttttcttgtcttcagtttatagtttcaacatttcaaatttttgattaagtttttttttaatttttgaaatgttaacattacttaatttcagcaacaactggccgaatgacagaagctagcagcacatcaccaattctcccactttgcccagcaccaactgaaaaaacggtggaccacttttacaacagctcgatcgccgaaatgtgcaaaacattacccgatgatgctcaaattgctcgaattttcacaagcgtaaaaggaactagcaaacctgaaaagcacgcatt