Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:53-c8   

Cenix:53-c8RNAiCenix:53-c8
PCR_productcenix:53-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F21D5.1 Source_evidenceePCR518WS150 Sequence/Annotation Release
Chunk_score Abs_score476
Max_abs_score476F21D5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV87261178726678
Overlaps_transcript F21D5.1.1 Source_evidenceePCR518WS150 Sequence/Annotation Release
F21D5.1.2 Source_evidenceePCR518WS150 Sequence/Annotation Release
WB_DNA_textTH:53-c8562tgaatgctactgatgccgagctcccagccgcagttcgagctcttgaaaaacaaatttcagtcggaaagacccaactttcccgtgtcgtttgtggtatggacacacgttgctctggtccttgtctgatgaatgcagcaagagccggtgcagcgttattcaatgtacaattcgatgatatcggtgttgtgtcgactccaatgcttcattatgctgtcaaggcattcaacgagccaaaattcgcagagccaactcacgatggatattattctgcaatcgccgattcgttcaagaagctgtatgaaataactgaggaacccaaagactcgaggtacggttcagagaaaaacttgccattaaaaaagtattcttcagatatcaaccaaaagtcattgtcgattgcgcaaacggagtcggtgctccacggttcagaaatcttcttgagcgaatcccatcatcacttctggaagttgaatttcgtaatgaatcggaagaactgaatcagggatgtggtgccgatttcgttaagatttcgcaaaagttaccagcaaacttctcaccgaca