Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:54-d11   

Cenix:54-d11RNAiCenix:54-d11
PCR_productcenix:54-d11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY49F6B.2 Source_evidenceePCR521WS150 Sequence/Annotation Release
Overlaps_Gene Y49F6B.2 Source_evidenceePCR527WS150 Sequence/Annotation Release
Chunk_score Abs_score441
Max_abs_score441Y49F6B.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII35029583503691
Overlaps_transcriptY49F6B.2 Source_evidenceePCR527WS150 Sequence/Annotation Release
WB_DNA_textTH:54-d11734ttcagctcaaaatgtctgcgctctacttcaaaaagctacgaaaacagcagaatcccgacgtttcaagcagcgaagattcggattccgacgaggaaattccaaaaaagaagcaaaagcaacaagtaatcacaaaaaacggcgatttttgcaaatttttagcgaaaaaaaccgaaaatttcccagaaaagcaccaaaaaaatcgattttcagaagcctgtcgccgaggaattcgatgatttcgtcgttgacagagccgtacgtgaagaagcgccaaaagaaggagcttttgaggcagttgacctgctcggaacatcctatttggagccatatgagatggataaggacttgcaggagcttctggaaaagtcagttgtcgggccgaagtttgaaggcgatcatcagcctcaaaataggcttttaggccggaatgcggccgccaggctgaagaaagtgcgttgaaatcgatgaaaattcgattaaaatcgctcaaaatccaataaaaatcgctatttttccagtcagaacgcgaaaaaaccaaaggatccgcttggttcaaccttccagcgacggagctcaccgatgagcacaaacgagatttggaattccttcaaatgagatcaactctcgatccattggctcattatcgtcgaaatgaccgggctgtactgccgaaatacttccaagttcgagaaaatttaaaaaattcccaaaaaatccgagatttttcaggttgg