Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:54-f7   

Cenix:54-f7RNAiCenix:54-f7
PCR_productcenix:54-f7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK616.4 Source_evidenceePCR512WS150 Sequence/Annotation Release
Chunk_score Abs_score428
Max_abs_score428ZK616.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV53952685395929
Overlaps_transcript (2)
WB_DNA_textTH:54-f7662attgccgttcaagaagcacttcctgatgatactattgagaaacaagaggctatggaagaagtacgcagtttcaatttttaattcattttcaatgaaatcattatttttagggtgataactcgaaagtgcaaacaaaacgcgagaagaattttttcatcggaacgaccaaaatcattgtgccacgcgccagaactaacatggaaagttttatgaaagaaggattaagtgagtaatttgacagaagttaaagttaaagttaaaaacaaaaaaatgcttttcagtcgaagattgggagttgttcgaaaagattgtggaacattcgtatgagaatatcctctactccaatccatctgaacatccggttttgttttctgaaagctcggtaagaacattaaggattatttaataagaaacacttgttttcagtggaatgaccgtgctcgtcgggagaagctgactgagatcatgttcgaaaaattccaagtccctgcgtactacctctccaagaatgttgttctttcctgtttcgcacaaggaagaacgcacggattgatggttgattctggagcaactcaaacttcagttgttcctgttttcgatggctacgcagtgactcacgcggtggtaaaatgtccaatcggcggcgatctcatcacagaaca