Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:56-c9   

Cenix:56-c9RNAiCenix:56-c9
PCR_productcenix:56-c9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY46G5A.4 Source_evidenceePCR555WS150 Sequence/Annotation Release
Overlaps_Gene Y46G5A.4 Source_evidenceePCR555WS150 Sequence/Annotation Release
Chunk_score Abs_score513
Max_abs_score513Y46G5A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1272780312728412
Overlaps_transcriptY46G5A.4 Source_evidenceePCR555WS150 Sequence/Annotation Release
WB_DNA_textTH:56-c9610ttttccagctcgagaagctcaaagacagatgtgacctctttagcttttgctcgttcgagaagagccgccgaacaatgcggtaactgcttcaagtacggctcattcgagtacatcgcctgtgtgagcatctgtgagagctccatcgcgtgaatcgccggcgacaaccatccattcgaagagagcacgtcgacgcaagcctgaacgagtcggcacgcgcggagcacaatgagctccgtgtccttgttgagctcggcggtcagtttgacacgtgacaaatgagcatgaatgagcaagttgactttgacgtggggatccgtgaacttttgattcttaagctgtcctggaaggcgttcggcgagctgtcgaagaatcacatcctccttgtgacgcatcggaacatttccgaattcactggatgctgagatgatctcgatgagagcgcgtgtcttggttttctccttcagtgacattgagaagagctctgaaattgaattaatgaaattttctttcaaaatatttcagaaaaaaaaactaaccaatcgtctgataactgatataatagtacgaggcaatcattcccaaattcaacgagaccgtgtccatctcatcc