Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:56-h2   

Cenix:56-h2RNAiCenix:56-h2
PCR_productcenix:56-h2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M110.4a Source_evidenceePCR513WS150 Sequence/Annotation Release
M110.4b Source_evidenceePCR513WS150 Sequence/Annotation Release
Overlaps_Gene M110.4 Source_evidenceePCR513WS150 Sequence/Annotation Release
Chunk_score Abs_score492
Max_abs_score492M110.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII82191248219636
Overlaps_transcript M110.4b Source_evidenceePCR513WS150 Sequence/Annotation Release
M110.4a Source_evidenceePCR513WS150 Sequence/Annotation Release
WB_DNA_textTH:56-h2513aacgtcctctcaccgaagaattcatttcctacaatgtatcctccaacgatgcgcagctcgctcaagttgtcgaaatcgtctttgacaaggcagttgaagagccaaagttctgtgctttgtacgctgaaatgtgtaaggctcaggcgaatcatgaactatcccagaccggcggaaagtcagccttcagaaataaggttttgactcggacgcagatgacattccaggataaaaaagacattgatgcagacaaactggcaatcatcgaaaaagaagaagatccagtgaaaaaggaattgatgcttgcagaggagaaacagaaatttagacggagaaagttcggagttatgacgtttatgggttatctgtatagaaatcaacttttatccacaaaaatcgtccaaacgtgtacattcgaattgttcaattcgatcaaggaccaagatattaaaaaagaggatgtcgacgaggaatctattcactgtggtcttcaactcatcgagactgtaggcgtga