Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:57-a6   

Cenix:57-a6RNAiCenix:57-a6
PCR_productcenix:57-a6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08D12.1 Source_evidenceePCR548WS150 Sequence/Annotation Release
Overlaps_Gene K08D12.1 Source_evidenceePCR592WS150 Sequence/Annotation Release
Chunk_score Abs_score550
Max_abs_score550K08D12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV17088581709514
Overlaps_transcriptK08D12.1 Source_evidenceePCR592WS150 Sequence/Annotation Release
WB_DNA_textTH:57-a6657cgcacaggggaaaatacaatagaagatcgaaaaacgaaacgattttagaggacttgttcgatgtgcggtgggaaagagagatgtggagttggtgtctgcacgaatgggaatcctggtttgtcgggacggaacagctcgaactgtgagccggctttgttgatcacggcgagacggacaactccgccggaggatccgtcacggaaggtggcgagtccgacggcttgcttcacgatcgccttgcactcctcgagcgtcaagtttggtctccattgactgtcgaggaagccctgcacgaatgtggaaccggagccggaagctgtcgatcgctggcgggacacgaatcctccgattgggattgcgtagacctggccgccgagctcctcatcccagccggcgacgagcactgaggcggagagctgctcgcggtagttgtagaggaattggcggaaaatctggctcgagcggtagattgtcactggcttgttctctgtcatgctgaaaaaagtgattatttaaaaaaattattttatttaattttaaaacaactgaaaattccttacgtataaacatcaatatggtacttggcaatatcggcgatcgcttgagtgtccgctgcagatccagaacggcacacaaccatattatcggtgatcgggg