Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:57-d5   

Cenix:57-d5RNAiCenix:57-d5
PCR_productcenix:57-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F56B6.4a Source_evidenceePCR591WS150 Sequence/Annotation Release
F56B6.4b Source_evidenceePCR591WS150 Sequence/Annotation Release
F56B6.4c Source_evidenceePCR591WS150 Sequence/Annotation Release
Overlaps_Gene F56B6.4 Source_evidenceePCR591WS150 Sequence/Annotation Release
Chunk_score Abs_score507
Max_abs_score507F56B6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX35376343538376
Overlaps_transcript F56B6.4a Source_evidenceePCR591WS150 Sequence/Annotation Release
F56B6.4c Source_evidenceePCR591WS150 Sequence/Annotation Release
F56B6.4b Source_evidenceePCR591WS150 Sequence/Annotation Release
WB_DNA_textTH:57-d5743tgaggcttggatcacacttgcaacaaacgataattatgctcagggagctctcgtactagttcactcacttagaactgctggaacgacgcgcaaaattcattgcttgatcagtaacgaggtacatatttcattgatttttttctgattttttgagaatcttattataggtttccgccccagttagaaaacagctcgaagaacattttgatgacgtctccattgtcgatgtgttcaacagcaacgactccgataacttgcgtctgattgagcgcccagatcttggagttaccttcaccaagcttcattgctggcgtctgactcagtacaccaagtgtgtgttccttgatgccgacacattggtaacaaaattttcgaacctaataataataagtagtacttttcattgcaggttctccgcaacgctgacgaactcttcacccgaccagacttctcagccgcgtccgatatcggatggccagactcattcaacagcggagtttttgtgtacgtgccaaacaacgaaacctacagtgagtgtggccaacgactttcagaaaatcataaaaccaaaaacaaatttcaggacaactcgtcgattttgctgtaacacatggatcttatgacggaggagatcaaggattattgaacgacttctttagcaattggagagatcttccatctgagcacagacttccattcatttacaacatgacagctggagctttctacacatatgccgctgc