Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:57-d7   

Cenix:57-d7RNAiCenix:57-d7
PCR_productcenix:57-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T14F9.1 (3)
Overlaps_transcript T14F9.1.2 Source_evidenceePCR568WS150 Sequence/Annotation Release
T14F9.1.1 Source_evidenceePCR568WS150 Sequence/Annotation Release
WB_DNA_textTH:57-d7713gaaagaagagcgtgaccaggttcttgccgctaacaatgccaatggacaggcagctaagaccatggcaaacctcatcactcaagtcgccaaggatcagaatgtacgatatgtgcttactcttttcgacgacatgcttcaggtaagaatttacaaaggtcttgtgatcaataatagaaaaaatattcaggaagacaaatcccgcgtggaacttttccactctgcggctgctcgtcagaagcgcaccgtctggtcgcaatatcttggaatcttgcaacgacaagataatttcatagtcaaccaggtattttttgggtgttaaatgttttggcattaattatgtcgtaatccagatgagctccatcattgccaagcttgcctgctttggaacaactcgcatggagggacaagatcttcagtactacttctccttcctcaaggagcagcttaaaaactctacggtaagagtttaagtttgcaattttaattttatgaatttaaagtttcagaccaacgactacatgaacaccactgctcgttgccttcagatgatgctccgtcacgatgaatacagacatgaattcgttgattctgacggagttcagactcttgtcactgctctcaatggaaagaccaacttccagttgcaatatcaacttatctttgctgtttggtgcctcactttcaacgccgacattgccagaaaagctccatct