Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:59-h3   

Cenix:59-h3RNAiCenix:59-h3
PCR_productcenix:59-h3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01B2.11 Source_evidenceePCR509WS150 Sequence/Annotation Release
Overlaps_Gene M01B2.11 Source_evidenceePCR509WS150 Sequence/Annotation Release
Chunk_score Abs_score488
Max_abs_score488M01B2.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1524239515242991
Overlaps_transcriptM01B2.11 Source_evidenceePCR509WS150 Sequence/Annotation Release
WB_DNA_textTH:59-h3597attgcaactctgggcttgttaatcttctcaacccaacgcttcatatgaaattttacagatacagctctgatgaataccaataaaattgccaaccagactgatagacgacggcctaaagtgtcaacttgctgcctcagccttaacaaagggataaaagatttgtagtcgcttctcaagcactgtggaggaatagggtaggtttcaggtagcaatgagagttttacagcaaaattttccaaactaataatagcaattgttaaatcggcaatacaaattccaatcatgattgtgtaacttccggatgatctcagctctttgtgaagcagaataaataaatggaacaaatttgagaaacatgaagctatccaaaaatagtcttgaaataattgaccagacaggtcaatcgcatgaagcagatcatataaatcgaatgtatcggtggaatttatttcgaagatctcatattcatcggtggaatttgtgaagttttcttcgaaggtatcctccattagaaaataaaaaaagtgacagaagcttgtgatagtcagatggtgctggctcacatataattatgcttcgagttagggaaagtgcagc