Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:60-h3   

Cenix:60-h3RNAiCenix:60-h3
PCR_productcenix:60-h3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22H10.1 Source_evidenceePCR520WS150 Sequence/Annotation Release
Overlaps_Gene F22H10.1 Source_evidenceePCR520WS150 Sequence/Annotation Release
Chunk_score Abs_score457
Max_abs_score457F22H10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1670266216703277
Overlaps_transcriptF22H10.1 Source_evidenceePCR520WS150 Sequence/Annotation Release
WB_DNA_textTH:60-h3616gacattgggaagcagacaccaggacggctgtcgttcaacaatttgatgcgagtagcgtacactctcggaaatacgctgtgttacattcacgatagaggcttcattcatcgagatctgaaagcagacaatgttgtcgtgactttttcaaatgaggtgagttgagagtgaaacattaaataatatgtattctgaattttttcaggtgtgtactctgaagctgattgattttggaaaagccatcagaatcaaggatcaaaatggaaatcaacttccaggacatcaggatggaatagattattcccgctgcagccaacacagtgtaaacgttattttgggaattgctccaactcaaaatgacgattggtcttccctggtgtatttactgatgaagatgcgtggattttcgtggggtgatactgcggaggagatgctggatctcaaagtacaatttgtaggtttcctttcatttggattcaaaaaaaaatgtttttttttcaggagaatgatccaaaggatatgattgctcaggacatgatgtggatgcgccagatttatcggaacgccgttaatgaagatatggggagggagaacaatcgaggaatcgtcgacaaattgg