Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:62-b3   

Cenix:62-b3RNAiCenix:62-b3
PCR_productcenix:62-b3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R166.5a Source_evidenceePCR560WS150 Sequence/Annotation Release
R166.5b Source_evidenceePCR560WS150 Sequence/Annotation Release
Overlaps_Gene R166.5 Source_evidenceePCR560WS150 Sequence/Annotation Release
Chunk_score Abs_score518
Max_abs_score518R166.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1054512710545785
Overlaps_transcript R166.5a Source_evidenceePCR560WS150 Sequence/Annotation Release
R166.5b Source_evidenceePCR560WS150 Sequence/Annotation Release
WB_DNA_textTH:62-b3659acaatctccgcgtcctctaaagacagcgaagtattagtaatcatcaaatttactttctcctccatttccaggctccacagtcaatgaacaaactgagtgcaggataagaaggaattgaaccaacgattggttgagtgggaatagcgcacgcaaccgactgcgccacaagtgtcaatcgaattcgattggcaaaggggttaacaaaagagacggttactaacctgtccactggatcacgtttgagcagattcgagaccaaatccttggcctcctcggagatcataccccactcttcttctggaaactcgtagtaaccatcttggatgcgatgaaacaagtcttgttggcagtcctcgcatggtttaccctcggaccacctggaaaagcgaatttcaagataaacatgaaaaaataaatacttacccgcaatcctcatcatcacacattccttggaatggagcatatccagccaacatgatgtagaggattactcctaaactccatgtatcacacttcttgtcgtacttcagagaatctccaacataagcgtcgacgacttccggagccataaactcggccgatccaactggagaagcaagatcgggttccgaagccacctggctcaacggatgacgttcgtgttgtggtggacgttgact