Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:62-f2   

Cenix:62-f2RNAiCenix:62-f2
PCR_productcenix:62-f2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR11G1.4b Source_evidenceePCR528WS150 Sequence/Annotation Release
Overlaps_Gene R11G1.4 Source_evidenceePCR528WS150 Sequence/Annotation Release
Chunk_score Abs_score444
Max_abs_score444R11G1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX36472743647948
Overlaps_transcript R11G1.4a.2 Source_evidenceePCR528WS150 Sequence/Annotation Release
R11G1.4a.1 Source_evidenceePCR528WS150 Sequence/Annotation Release
R11G1.4b Source_evidenceePCR528WS150 Sequence/Annotation Release
WB_DNA_textTH:62-f2675catcttctgggtcaatccgtcaaatcgtttgtaagtgaaatcaacaaactctcctcgtcgaccaggttgttcctccgggcggattagtgttgatgtcgctgaaattaaaatcattttacacgcaaaaacgatagagagcatacgccatgtcagatcctcgtcgggaaaatcatcaaagttggaagtgtcgtcaatgctcttcacggtgacccgaatcggaggtggtcgttctctaatatggttccaatcgattcgtttaacaaacggacactgtttgatctcatcaagtcccccgtggtttccgagacgacgttcagcttcgcaacagaatcgtttgattgtctaaaaaatcatgttgagtaaaaaatctcaaatgcaactaagaatactcacagctttagcttcaatactgatgggcacatctgaagggaaaactaaagtctgctgccagttaatgacctttcgatacgtttcttgtggaagctcagagcagaatggtgggtagcctgaaaattattaagttttgaagagtgttggtacatcaaattttactaaccaataagcatctcgtacataataacacccaaactccaccaatcacagctttttgtgtagccatttggttggaaaacttctggtgcaatgtaatccggagttccgaccgtagagtatgcc