Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:63-f12   

Cenix:63-f12RNAiCenix:63-f12
PCR_productcenix:63-f12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (7)
Overlaps_Gene ZK1151.1 Source_evidenceePCR529WS150 Sequence/Annotation Release
Chunk_score Abs_score487
Max_abs_score487ZK1151.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1177494711775523
Overlaps_transcript (7)
WB_DNA_textTH:63-f12577cgtaatctcgtgttgcctcacgatgtcagcgacttcgaccattccattcagaaccgactccaatacctgaaacattaaactttcttgtttgaaataagttccttaatttcccaccttgattcgctcgacgtacatccttgacaaatcccacaagtcatcccaaagcccattcaagcggtcatgattgacacgctgggttggtgttggattcggaagttgacggaagagctccttgacattggccacgtcactgtccaaggcttgaagagcatcctcaaatctcttgtgagcatgaatgactcgttcaagatcttccggcgatcgggagattggctttccgacagcatcattaagctcacgccaagcttcctccaacttcttcagcaactcggccatcttctgatcgtactgagaagcccaatctggctctggaggcttttgactcgcattgagcaagttccagaagtgctcgttggttcttcggagctcttcgcgaagacgcaacgccaatggatcatttggatcgagctcgctgagcagtttgttagcatcatcgttcagtgccttcatgatagcg