Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:64-g1   

Cenix:64-g1RNAiCenix:64-g1
PCR_productcenix:64-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK287.4 Source_evidenceePCR569WS150 Sequence/Annotation Release
Overlaps_Gene ZK287.4 Source_evidenceePCR569WS150 Sequence/Annotation Release
Chunk_score Abs_score527
Max_abs_score527ZK287.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV96835839684197
Overlaps_transcriptZK287.4 Source_evidenceePCR569WS150 Sequence/Annotation Release
WB_DNA_textTH:64-g1615atcagagttggtggtggaggaggaacagccgacattggactgttggccagagctatgaattgaaaactagttaaatattctcatttgaatgaactcacaactaaatttaattccatttgccacacatgtttccagacaatcagtaagtgaatcaaaattgttctgatttccaccttctccagaatatataaaatgaaggcattgtcgatattccggagagaagaaataccgggaaagatattgatctccttgaccactagctgctggttgtgaacattgtgatgatggtggtggcattggagattggcaagtcttcatacaatcatttcgagtcaaaaaattattcatattaccaccgtgtccagaataaaggaaagatgtgcattgacctgcagagtaagcccaacgatgttcagaaagaactccgaacccaacatcaatgggttgaccacaaagattgttcgaagcatgggttgcaggtacaaagtcaattaccatattggacgattgttcttgtggctgagaaacttgagcgggaggtgcaggaattggcatctgaacaggttcgaatggtggagcaggaattgattcaggaacaagatggctcgtttttgg