Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:66-a8   

Cenix:66-a8RNAiCenix:66-a8
PCR_productcenix:66-a8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K10C2.4 Source_evidenceePCR666WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX64467886447682
Overlaps_transcript K10C2.4.1 Source_evidenceePCR666WS150 Sequence/Annotation Release
K10C2.4.2 Source_evidenceePCR666WS150 Sequence/Annotation Release
WB_DNA_textTH:66-a8895tagatatcggctggcaggacttttccgcggcactctccgaaaccaattctgactccattcttttcacaaactccagaaaggttgacctcatctccgtcctttaagaactttcggatttctgagccaactggaacttctttggctccgcgccacgaaagctcgagcatggatccatatgcaccttcttctggtccagatacagttcctgatcccaaaagatctccagcgcggaggttgcatccattgacggtgtggtgagcaagttgttgttttagagtccaatacaaatgctagaaattacagtattgtagttgagaaaaccttaacgagcgtttatgatccaatttacagtgaacagtgtagataatatcgtttctactaaacttgaacataccttgaagttagttttacagacaatatggtccacagcatctccttctggacggatactgacggccaaattgatgtcaagggtaaatgggtcatcgtgatggagatatgctggtggaactggatcttgtactggattctcaacaaagtatggacgaagagcttcaattgagacgacccatggagaaacagttgtggcaaaggatttagcaaggaatgggccgagtggaacgtattcccaagcttggatatcgcgagctggaaaagttttttttcggatgagtatggagcaaacttgaaaataactactgttgaattttcttgtcaccaaaatgtcgagtttaaatgtttttgtttgatatttaattaacatcgttactcaccactccagtcgttcatgagcacaactccaaagatacgatcctcagccttctcgattggaacacgagttcccaattcattttctggacctcccacaaagaacgccatctcgagctcaaagtcc