Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:66-f4   

Cenix:66-f4RNAiCenix:66-f4
PCR_productcenix:66-f4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10D2.9 Source_evidenceePCR502WS150 Sequence/Annotation Release
Overlaps_Gene F10D2.9 Source_evidenceePCR502WS150 Sequence/Annotation Release
Chunk_score Abs_score439
Max_abs_score439F10D2.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV71540087154858
Overlaps_transcriptF10D2.9 Source_evidenceePCR502WS150 Sequence/Annotation Release
WB_DNA_textTH:66-f4851tatggacaaccaacgcgtaatgataatgaatttacatgatcgatttttttcttgattcttcacttccgtgattggcaacctgccggctgataaactcatcggcaattgtttttctatcgtagacaagaccaagaacagctgcagtatcaataagaacacgggtccaattgtatatcaatgaatattcagatgctctgtagtcttgtgggaatgtgtggtggaaattgtgacctccttcaccaacggctacaactgtggtaaagacgttctcaacggcggaaacagaagtatcgtatggcttccaaccaaaactgaaaattttaatttaataatttcaagcttgatttatttttctaacgatgaaaagaaaacagttttaccgtaaacttaaaaacaaaacatttgtattttaaaaactttaatttagaccaagtcatcacagaaattttgacagcgaacttacctattttctttgttttggtcccgctaaacacttgaagattttaaatttaaatttttgttttgcactgggtaataaattgtaaaacgaccccgaatctataaaaataaagtgaacttactagtgagcagcgctgttgatgcaccaagtggcgtgaagtgtgaaacaataacggaatgttccagctacgtaaaacgcaatgaatgctgtctccttccagaaataaacggggataattgttggaagaatgaaacaaaacaaaatgaccagtgggaaatagtgcctgaaataaaaaattgacatattttttatttatttcaacctaacttactttctctggaatacaagaactggatcgctaaatagatcagataggtcgagtttgcctcca