Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-a9   

Cenix:72-a9RNAiCenix:72-a9
PCR_productcenix:72-a9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST21B10.3 Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene T21B10.3 Source_evidenceePCR525WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462T21B10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII89345998935477
Overlaps_transcriptT21B10.3 Source_evidenceePCR525WS150 Sequence/Annotation Release
WB_DNA_textTH:72-a9879tgatttgctcaatcacctcgttatctacctgaatgaggagattgtggaaacttcttccaaagcgtgtccggatggaatggacgatcgacatttcgtgcaactcgaaaaacggatgcacttgatgttcgaggtatacttggcaatgaatgtcgttcccgattatctgattcctgatctcacaaaacacgttgatgcaagccgtgaagctgttaagtattcatatagcctctgcaaaggtacgtttcgataattgttaaaatattttattgttttttttgcagactattaccgctggaaagaactgccattaactctcaaagaattttttcttgatgagaaagaggaggtgaaggctgttgtcgatgaaccagaaccgacaatgtttgcacgcgacgacggggtagtatcatcattggctcatgagaaggcacaatcagacgaggatgggaagaagaaacagttcgtggcaaagaccgagaaggtagtagagccccttaaaaagaaaaagaagcagaaaaagaagaataaacagcgccagtgaaaaatcccatttattcttgtaccatggcgagtttcgtgtcttaaaattttatatctcacaaaatctgaacctgtgcaaatgtttgttaaatttatcccgcaaaaattcgtattgtgattctattcgtttttgtcttgtgatgatcatcatttgattcagtatttagtctagaaaataaaaatttcagctttctctgtgtctggtatcaaatgcattttatacaagttacttagactggtaaatttccaggttctcaacaattatcgcgccaagaatcctgactacagaacgatgcgcgagttgattaatgcgaaaacaaagttccgtctcgagggaat