Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-c1   

Cenix:72-c1RNAiCenix:72-c1
PCR_productcenix:72-c1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53B7.5 Source_evidenceePCR529WS150 Sequence/Annotation Release
Overlaps_Gene F53B7.5 Source_evidenceePCR529WS150 Sequence/Annotation Release
Chunk_score Abs_score507
Max_abs_score507F53B7.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1097373110974370
Overlaps_transcriptF53B7.5 Source_evidenceePCR529WS150 Sequence/Annotation Release
WB_DNA_textTH:72-c1640cgaccggtgaaagagacattagtgtgatatcaaattaaaagtgaacgacaaaagtgatatattgacctaattagatctcttctgaccagaaaattttacattacaactcactgttgctgcgggagctagtgttgtggtagttgctgctgttgttgctggtgcaacagttccacaacttaatgaggttatcactgttccatctggagtgacccattgtgagttggaattacacgttagagtcatgaatgtagaaccaactccagaagatacttgattattgtttgaacccagaagagctgcggtttgcgatgtgacaggtgaagcacatgtgatatccgcagacattattgatccagaagttgttgtgtcaacagtcataaatccacttgtatatccaggtgtggacactgccgtcacgaatccggtgttacagcttgctgatggtccactagaactttgtgttgttgatgaaggagcaggagttgtaattggcgctggagatgttgatgttgctccaaccacagatgttatcatgcaagcaactccatcgatttcgattccatttctttgccacgtattggatgaggagcatgccattgaagttgcaacttgaccatacatggcagataacgattgtcca