Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-c6   

Cenix:72-c6RNAiCenix:72-c6
PCR_productcenix:72-c6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene R11A5.4 Source_evidenceePCR505WS150 Sequence/Annotation Release
Chunk_score Abs_score484
Max_abs_score484R11A5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78704537870957
Overlaps_transcript (10)
WB_DNA_textTH:72-c6505gggatgctcttggaaatcaagattttgttcgttgtatccactctgttggacttccacgtccagtcaagcaacgtgttatcaaccattggccatgcaatccagaacgtgttctcattgctcatagaccaccagagcgtgaaatctggtcttttggatccggttatggaggaaattcccttcttggtaagaagtgctttgctcttcgtatcgcttccaacattgccaaggatgaaggatggatggccgagcacatgcttattatgggagtaacacgtccatgtggtcgcgaacacttcatcgctgctgctttcccatctgcttgcggaaagaccaacttggctatgcttgagccaactcttccaggatggaaagtccgttgtgtcggagatgatattgcatggatgaagttcggagaggacggaagactctacgctatcaacccagaagcaggtttctttggagttgctccaggaacctcaaacaaaactaacccaatggctgttgc