Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-c7   

Cenix:72-c7RNAiCenix:72-c7
PCR_productcenix:72-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T02E1.3a Source_evidenceePCR540WS150 Sequence/Annotation Release
T02E1.3b Source_evidenceePCR540WS150 Sequence/Annotation Release
Overlaps_Gene T02E1.3 (3)
Overlaps_transcript T02E1.3a Source_evidenceePCR540WS150 Sequence/Annotation Release
T02E1.3b Source_evidenceePCR540WS150 Sequence/Annotation Release
WB_DNA_textTH:72-c7643aaagatttgcgatcactggcgacgctcgggcagctgttcgtatggcgacgcgtgctggtatgctcacggtgaagacgatcttcgtaaagtggtcagttaagcagcgtaggaaacatcaaagaaatctggtttttcaggtccggattgatcgttcgaacgaagaagagaatgagcgaccggctactgctgaaattcaaaagtcgccgacaaagcgtgcatcaaccaacgtcaaaggattaacagtgaatattccatcgaatactgccttcaaagaacaaaactcttcgatgccgttatctccagctcaggaaagatggatttccatgtcaattggagctgtaccaccaccaaccagctcagctgcagagaaggatgcgatttcatcattatctaaaaacggtgtcgagcaagaacaggaaaagaagcatgaaatatgttctcgtgacgatgatattgacgattacggatttttggttagttttgtaacttcaagaataactttcggttgaaactgaacaacttgttttcagtctccgaatccgttcccatacccgcaacagtcaatgttctcagctggatttccatctcatggacaccatcaacgttcctcgaatcgtgctacgcaaggggttccttctcaaca