Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-d1   

Cenix:72-d1RNAiCenix:72-d1
PCR_productcenix:72-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F10.2 Source_evidenceePCR522WS150 Sequence/Annotation Release
Chunk_score Abs_score501
Max_abs_score501F53F10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38330323833553
Overlaps_transcript (7)
WB_DNA_textTH:72-d1522gtcgtgtctgctttgggaatctctctgttccaactggagccgatggagctgtgaataatgaattcatgtcattttgcaactctctcaacaatgtcattgatgacctatttgaatctaatattgatttctctgcaagcatcggacgtttccttgtgacaaatgcattcacattgtgcacaaatgttattggaaaacgtgcaatggacgccaaatttattacaaacgatgatttcgatgatggagttggatttgtatatcaaaccaatgatggtgtatatggatcatttggatgcaagcaaatggatattaaaccattgtgtaaaccattggatgttgagaatgactctgaagagcaactacatttcggaacgattctcggcccaactttggatggaaccgatgttgctcaaagactcatgaaaagccgtcaattgcgtgtcggcgagtggctcgtttgggaacaaatgggcgctttcacaattcctgttgacagtgagcattcggtgccgcctgtgtattact