Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-f11   

Cenix:72-f11RNAiCenix:72-f11
PCR_productcenix:72-f11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48B6A.8 Source_evidenceePCR616WS150 Sequence/Annotation Release
Overlaps_Gene Y48B6A.8 Source_evidenceePCR616WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1420746014208076
Overlaps_transcriptY48B6A.8 Source_evidenceePCR616WS150 Sequence/Annotation Release
WB_DNA_textTH:72-f11617agtggtcaatggattctccgaaacgagcaaaacaaaaatcaacagcactagccgatcttgtcggctgcaatcagacaaagatcactgatcaaactgcatgtcttcggaatactccggctcagctgctcattgataacatttggaacgttggcctcaacttcctcgagttcccattcgcaatcgtatccaaggatcagaactttttcaaacatctcgacggatttattgcattacgggagggaacctactcgacagatgtgaatctaatgttcggaatcaatcacgacgagggaaacttctggaatatttataatctcgcaaagtttttcgacaagcaatcagtgaagccaggcttggatcgagatgaattccatgaatgtgtggacactgcgttcgcagttcagccggaattagtccgaacagctgccaagtatgtgtactcggatccaaagtgtacggacccgaagaagaaaaccgatttctatacggaacaggtgaaccagatggtcggtgactacttcttcacgtgtgacagtatatggtttgcgcacaactatccgaaaatggccgggaatcaatcgaatgtttttgtctactattttgatcagccatccagg