Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:72-g4   

Cenix:72-g4RNAiCenix:72-g4
PCR_productcenix:72-g4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.8a Source_evidenceePCR508WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.8 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score Abs_score487
Max_abs_score487K04G2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80528268053333
Overlaps_transcript K04G2.8b.1 Source_evidenceePCR508WS150 Sequence/Annotation Release
K04G2.8b.2 Source_evidenceePCR508WS150 Sequence/Annotation Release
K04G2.8a Source_evidenceePCR508WS150 Sequence/Annotation Release
WB_DNA_textTH:72-g4508tccactgaatcggaacatcatcaattgacgtctcaacagcagaacactacacattatagcagtggatcagctaacactatgactcggagtgatggtgcaactactgtgccaatggataacattattacaccaacttatgctattttgaatccaatattggtacacgaacagacaccgaacgggacagttccacgaaagacttcagaagagttggatagtcctgatgatgttctcccaggtccatctcttgaggaggaagaaggtgattatgctataataggaggtgccgcacaaaagacagatgacgagcttttgactcgttctattcaatctgaaatgcctacttcgtcgtctactccgaagatgaaagtctcgcctcgccttaatggattcttctctccaactcagaaaacaacatcgtctcctgcatggtctcatccagatacctcaccgattccaaagtcatcttctcatcgaactcaacctaatcgtcgtcaagatgcttctg