Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:73-e7   

Cenix:73-e7RNAiCenix:73-e7
PCR_productcenix:73-e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0041.4 Source_evidenceePCR562WS150 Sequence/Annotation Release
Chunk_score Abs_score464
Max_abs_score464B0041.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46460574646801
Overlaps_transcript B0041.4.2 Source_evidenceePCR562WS150 Sequence/Annotation Release
B0041.4.1 Source_evidenceePCR562WS150 Sequence/Annotation Release
B0041.4.3 Source_evidenceePCR562WS150 Sequence/Annotation Release
WB_DNA_textTH:73-e7745gcgagcttgagaaggttgagtctctcaacattcatgacatcgactcctgggatgttgcggaaggcacgagcgcactcagcatcttgtccgtagataacaactggtccgagcttctgcttgtgttgacggttgcggagctttccctttccggcgcggtttctcttcgagttgtaaaccttaaaactgttacgttaaaaacaaatttaatttttttaaatggtataccttctcgatatcagcccacaagtgggagcgacggaggaagacgacggcctccttggtcttgcggaagctttcgaccttgtcggaaacaacaagtgggacctcagcgacctaaaaaatagtactgtaaataggaacaaaacttttaaaaaagtttacttacttgatcgatgacgtgtccacgagcttggagaagagctgggattccggaggcagcaatagctgaggaaacagcgtatctcttctgggcaatgttgacgttgcggtgccagcggcggaacaccttgagtggggcgaacatgtgtcctccacggcacatatttccgaaagctccctgtccggaacggtgggtacctcctccgcgaacacgtggaatacgggcaacggcacgtccagttccccaggactcagcagagtgttgctttcctgaaataaatagtaattgaggaacacagaagttagtttgaaattaaaataatcaataaccgaatctaattatgtcacttaccggccttggtgttaa