Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:74-b8   

Cenix:74-b8RNAiCenix:74-b8
PCR_productcenix:74-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32H2.5 Source_evidenceePCR507WS150 Sequence/Annotation Release
Overlaps_Gene F32H2.5 Source_evidenceePCR507WS150 Sequence/Annotation Release
Chunk_score Abs_score449
Max_abs_score449F32H2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89762038976808
Overlaps_transcriptF32H2.5 Source_evidenceePCR507WS150 Sequence/Annotation Release
WB_DNA_textTH:74-b8606tgtgatgtgtccaccgaagtttcttcttggcttgtacctgtaatgtttaaaatttaaaataaattttttaggtttctgaaactcacttgtcagccatgaggaacttggaatgcattgcctcacaggcaaatgcaacggtctctggtgacttgaagagaccagttagcatgacttgatccaccaccttttgcacacgggccttgaatcctggttgttgaaggagttcaaatcggaacttcttgtaatccacattggcgaaacgaagagtcatggcacacatgatctcagattcgaagagtggattgttgaccagggaatctcccgttactccaaaggccatacggtatacctgagaagtttcaaatttaatttcgaaagccataaactagctcaacttacgtttctgtaagtttgcatgtagagatgggatccatcgagaagaatcaatcgttcaacagcatctcttccgtcggactcttgaagcatattggccatttcaaatccaatgcaagctccgtaagaatatccaacaagacgatatggtccagatggttgaatcttcttcatttcacgaatgtagcacttggcaacatcctcgatggaagt