Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:74-c4   

Cenix:74-c4RNAiCenix:74-c4
PCR_productcenix:74-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C36B1.4 Source_evidenceePCR512WS150 Sequence/Annotation Release
Chunk_score Abs_score449
Max_abs_score449C36B1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87276338728451
Overlaps_transcript C36B1.4.3 Source_evidenceePCR512WS150 Sequence/Annotation Release
C36B1.4.1 Source_evidenceePCR512WS150 Sequence/Annotation Release
C36B1.4.2 Source_evidenceePCR512WS150 Sequence/Annotation Release
WB_DNA_textTH:74-c4819ttcctcgctgtattgctcctcaaggtattcacgcactggtttctctcctcttccagtcgcgttggcaacgtactcgtagtaagctccagatggctcggttttgaaaagacgtggagttccgtcatgatcgaatcctccaatgagcattgaaattccgaatgggcgacgtcctggagattgtgtgaagcgctgaaaatcagtaaaagttatgcttgcataaataaaatatttatacctgcttcgtgtttgcaatatatctggagatataggcaacggtaactggatcttcaagagtcaacttgtacgactggcactcgatacgagcacgatcaacaagaacacgagcatctgcggacaatccagcaaaagcgagcatcacatggtcgtcgatcatatgaattttacggattgtgcggtcatcttgaagagctggaattgacttcttctcaacaccgataacaatgcaatcctttccgcgaacaccgacctgaaacattcataattataacttgaggttttaaaaataaccgtattattttgaaccataattcgggaaattttagatttttagatagataatatcaatcatctacattgaattttttgatttatttttaaatataaaacgataaatagatctaaaatcttcttgaatcgggtgcttcaattctagctgatatcatattcatatgaaagtgcaactcatataattttctgccaactgattttcatcaggggaaccactcaccgcagtcgaacccttcttgacagcttcctgggcatattccacttggaacaagtgtccatcaggggagaaga