Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:74-h10   

Cenix:74-h10RNAiCenix:74-h10
PCR_productcenix:74-h10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F28D1.7 Source_evidenceePCR482WS150 Sequence/Annotation Release
Chunk_score Abs_score419
Max_abs_score419F28D1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1239027112391086
Overlaps_transcript F28D1.7.2 Source_evidenceePCR478WS150 Sequence/Annotation Release
F28D1.7.1 Source_evidenceePCR482WS150 Sequence/Annotation Release
WB_DNA_textTH:74-h10816ccccaacaactttatgtcggaataacaagaacaacaaacatttacgaacgtggtctctccttctttcccttgaacagggcgatgagggaggtgttggcgaccttcacgatcttgaaacgaactccgggaatatctccgacggcgtgaccggaacgtccgaaaccagatacgagcacttcgtcgttttcctggaaaataataattgatttttttaattaaataaattttgtcagaaacggaggtgaaacagatgagcataacgcaagaactgtttgcataaagtacctaattcattttcgagcaatcctagcaccgaagagatacatattctcagaggtgactctggacctcgtatagattgagttattcaaaaaaaacaactcacttcaacaaagttcaagcaaccgtcatttgggacgaaggcggtgatcttctttccgttcttgatgagctggacacgaacgcacttgcggatagcagagttaggctgcttagcttcgacaccgctgaaaattatgaatttgaaatcttaacttcacgcttacagctaaaatcgaaaattaaaatcttataaaaagctcacatcttttcaagaacgattcccttggcgtgagaagctcctccgaatgggttagacttccagcgagttccaatgtgagccttcttgtatctcttatcgttccatctttgctcttgacgatgagtcttgagcttgcgagccgtgcagagtcccttcggctttcccatattacctagaataaaaatgtaaattacaaggacaaattttatatttcgaacggatatggcgataaaacg