Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:75-c7   

Cenix:75-c7RNAiCenix:75-c7
PCR_productcenix:75-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01A10.3 Source_evidenceePCR503WS150 Sequence/Annotation Release
Overlaps_Gene M01A10.3 Source_evidenceePCR503WS150 Sequence/Annotation Release
Chunk_score Abs_score444
Max_abs_score444M01A10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI55495115550108
Overlaps_transcriptM01A10.3 Source_evidenceePCR503WS150 Sequence/Annotation Release
WB_DNA_textTH:75-c7598attccaacttgggaccactgaaatttgagtccatcggtctttttcaatattagtagaaataacttaccaatacgacaagaatgagaagtggggaaaggcagataatggtgaacaaatcagaaatgagcgctgatggtctcttttctggttgacggaagatatgggagatttcgttcaatggctcaaagtgcacttgttgtgattttggggttggctcgtaggcaactgggagagccgcgtcgatgttagcctaaaatattaaataagaaaacattaaacatttgaaacaacttacaaattgccagttgattggattcttgatagttacgtctccaacgagaaggctgatcttgaactgtccactaaggttgcggaatgatttagcagcggtacgaagaacattatcgtaaacatagttgccattagcatctggattgactaccacaacaacatcttcaccattttgagcgacaaatcgaagaaaaacttgatgtggcttcactttggcgttgtcggatttcttggcaacggtgaacgagacgtagagacgctgagaagcatctgctttgagttcgtttggcagtttggagaagagtgc