Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:75-d1   

Cenix:75-d1RNAiCenix:75-d1
PCR_productcenix:75-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F10.5 Source_evidenceePCR528WS150 Sequence/Annotation Release
Chunk_score Abs_score486
Max_abs_score486F53F10.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38198013820378
Overlaps_transcript F53F10.5.2 Source_evidenceePCR528WS150 Sequence/Annotation Release
F53F10.5.1 Source_evidenceePCR528WS150 Sequence/Annotation Release
WB_DNA_textTH:75-d1578actcttccaaagccagcagaagctactccaactcttggacttggcctagggctcacttcaacaccattggctaagggaactgggtacattttggtttactttttaaaaatataaaaaaaactcttaatttcagatggacaacatcaggacttaaaggagctgcaactacatctgcaggcctgaaaattggtgcaagtggaagcgacacactttctgaagaagaaatcaaagcaggactcggtggaaatgatacaaaagccttcttcaccgcccttcaagaagttgtcaatagttatcattcggaaattgcgaagcaggaacgagtattccataataaaatgctcgagcttaatgcttatgaccgtgagctcattacactcgagccaaaagttttaggattgtacaatgagatggatgatttgagtggaagctgcaagaaactgcatttcaacgtcgcctccatgacttctgtcttgaacgatattgagcaaaatgttgttgagctagagaacaagctgagccttccagaatggcatactcttgattacaaattcccacttgatagcagatttgcgtcg