Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:76-c5   

Cenix:76-c5RNAiCenix:76-c5
PCR_productcenix:76-c5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02A11.4 Source_evidenceePCR466WS150 Sequence/Annotation Release
Overlaps_Gene W02A11.4 Source_evidenceePCR466WS150 Sequence/Annotation Release
Chunk_score Abs_score361
Max_abs_score361W02A11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1274159312742666
Overlaps_transcriptW02A11.4 Source_evidenceePCR466WS150 Sequence/Annotation Release
WB_DNA_textTH:76-c51074tgccttcctggagagaaaaacacgagaaaattgtccagtccaagattttggtgggttttaaaccaaaaaatacgttttccatatcgaaaatctcaatttttcaggttatcggcgccggtggcattggttgcgagctgctgaaaaacctggcggttacgggatttcgaaaagtccacgtggtaaaatttttcgtcgcgaaaatcgcttaaaaattgaatttccagatcgatttggacacaatcgacatttccaacctcaaccgtcagtttttattccgaaaagagcacgtttcgagctcgaaagctgcgacggcgacacaagttgtgaagcaattctgcccacaaatagagctaacctttgatcatgacagtatcttcgagaaaaaatacaatatggagttcttccaggcatacgacattgttctcaacgctctggacaatcgaggcatggaaaatcatcttttctggcagaaaaatctggaaatttggcttttttagcgcaaaaaagagccaatttagcctaaaaatgtgtttctaactacaaaaagcaaggaaaacataaatttgctatacaaaagtttcacaagtgaaaaagtcggaaaatgtgacatttttgccggaaacgctcaaaaacgtgtttttattcacataaaacgcgcagaaatacggttttacacataaaaatcctcaaaagcagtatattttacctgagaaaaaaggaaaaatgactttttcctgctgaaaatagtagaaaatttgctgttttggaaggaaatttcacttttttctaaaaattatccaattttcagcggcaagaaactatgttaatcggatgtgccacgcggcaaaccgcccactcatcgattctggatccggtggttattttggacaagtttcggtgagaaattcgctatttttgatgaaaaattaacggttttggccttaaaatgtgatttttggcttcaaaacacaaatttaaccgaaagttagtaattttaagttttaaaaatacatttttacgttaaaaattgcaatttttccaggtgatcatgcgtggaaagacggaatgctacga