Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:76-h10   

Cenix:76-h10RNAiCenix:76-h10
PCR_productcenix:76-h10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y52B11A.2a Source_evidenceePCR503WS150 Sequence/Annotation Release
Y52B11A.2b Source_evidenceePCR152WS150 Sequence/Annotation Release
Overlaps_Gene Y52B11A.2 Source_evidenceePCR503WS150 Sequence/Annotation Release
Chunk_score Abs_score461
Max_abs_score461Y52B11A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1096805810968909
Overlaps_transcript Y52B11A.2a Source_evidenceePCR503WS150 Sequence/Annotation Release
Y52B11A.2b Source_evidenceePCR158WS150 Sequence/Annotation Release
WB_DNA_textTH:76-h10852ctgagcctcactcaaaacccgaaattcatcgtttttgctcaattttcagcggattttctcgcggaaaaaaagctattaccatcacattatccgctttcattcgatccatgagctctaacattttcgaacttgctccaaattccccatcatccacacaatcatgatgatgaattggttttccattgatttcagtcatatatcgatatgctgtaatattatgtgttgcccggcagatttttgtattcgatttaaggattcgcatcactcgatccacctggaaaaaatggaaattatgactacaaactacaaaaaaaattgtgaaatttcagaattttaaaagtaaaatttccattttcacagcttttttttaaatatcaaattcaaattttttaatttataagcctttataggctaaggctaagacttccacgtggaaaactttcttggttgaggctatagaatattgtagtttgtagtgtggttgaggcttacatcttccttactccgaacctcggccaaatgagcctgaaatgcacttttccggtctgtaagcacttctccgtgtcgaatattcatatcatcgatttcctcggccatcggtgtcaccacgtcatcggccacatggctgggctccgctacttcttcgggaagatcctaaaactattttaaacttcttttttttcgcgtgttttcggtaaaaacctacccgaataaagtcttgaacaagggatatccaattgaaaatcactggaaatccgatattttcgatataaacgtcatttagactgttgtgaagcacctctttctgctcccgacggagatatggaccacttagttcgaaaattggcggag