Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:77-g9   

Cenix:77-g9RNAiCenix:77-g9
PCR_productcenix:77-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC18D4.1 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene C18D4.1 Source_evidenceePCR635WS150 Sequence/Annotation Release
Chunk_score Abs_score593
Max_abs_score593C18D4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1752386217524943
Overlaps_transcriptC18D4.1 Source_evidenceePCR635WS150 Sequence/Annotation Release
WB_DNA_textTH:77-g91082tttatcgcggcaggagtaacgataccttgattacgtatgagtcacgagaaaagaaaatggaaaatcaagaatttatcgatgtgttgattactgacttggaacttttgttgaatgaagtctccgatagattggacgagttcaatgtcacctttcgctggtgtggtgtcgaacaagtggacttggcgcatttacaaaatgtctatgatcaactaacattaataactagtcacaaaaaaatcaatgcatgtagtgttgaattggcagtcgaggatatagatcaagttcgcattgcttatacctgctttgatctccaaactttacgccattgtgcgtttcattttgttgacaatcaatttgaagacccggcaaatgcattcaggagaattttggagattgacgagttgaaatttctggattcaatcgaagcacacttcaaagttgaaaatctttcaattgatggtctaattgcgataaaacaggtacataaacaattagatatgtagattcgtaaccttaatttaagagaatctttgcaattcactaattgcttctaatctttctgttcaaatttcttcagaaatctcgtgattcattttttaaccaataagttttcaggttgttattgactctggtagaaaatgcaaagctgttatagacaattcaaacggaaacaaccttcaaaaccaagaattgacaaatattttcggagattcaattgaaaaataccaagaatggataatatgtcgctgtgaaaatctcaaatgctacatttacgaatcccggattgaaattcaaacaaaagagtggaagagcacgcctagtgagaaatatgtaagtttttgaaatatgtgttgtttgtacgtttttattaatttaatttaatattatttcaatattaatatcaaacttttaattttctacttcagatgagagatagaagaatgggatcatgttcggaagattcggaagacgaagatttcaagttgtggagagaatcgatggatattccaaaaaggaaaactagcagtcgtccttcgtcatatttcaaagaggattcttcaactaatggagcaagcccaaaa