Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:78-e1   

Cenix:78-e1RNAiCenix:78-e1
PCR_productcenix:78-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.4 Source_evidenceePCR500WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.4 Source_evidenceePCR500WS150 Sequence/Annotation Release
Chunk_score Abs_score440
Max_abs_score440C34G6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58905575891307
Overlaps_transcriptC34G6.4 Source_evidenceePCR500WS150 Sequence/Annotation Release
WB_DNA_textTH:78-e1751ccggaaatttaacggctagactcacggagtaagttaagaagtacattttttgaagaatgatagagaagtgagacatgttatatacatataatgagcttttgccgttcgtcaaatttttctagaaattcatctaaattcccggaagatcactaaagatattgcaaataataaatcatcgttaatctttttattgcagcgatttggagcgtgtccgtgaaggattaggtgacaaattcgcccttcttgttcaaatgtttgctgctttcttggctggatacggagttggcttcttttatagttggtcaatgacactggttatgatgggatttgctccgttgattgtgctctctggtgccaaaatgagcaaaagcatggcaacgcgaacaagagttgaacaagaaacgtatgcagtcgctggtgcaattgcagaagaaacattctcttcgattagaacagttcattcattaaatggacataaaagagaattggatagattttataacgcattggaagttggaagacaaactggaattgttaaatattgttatatgggtattggagttgggttcagtaatttgtgtatgtactcttcatatgcattggcattttggtatggaagtactctgattatcaatgatcctacttttgatcgcggtcttatttttacggttagtcatttttcaattcaaaaattcatgcttataaagcagtcatttaaaatattaaagagagagtaccgtttctgtcccca