Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:79-e2   

Cenix:79-e2RNAiCenix:79-e2
PCR_productcenix:79-e2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F55F8.4 (3)
Overlaps_transcript F55F8.4.3 Source_evidenceePCR564WS150 Sequence/Annotation Release
F55F8.4.2 Source_evidenceePCR564WS150 Sequence/Annotation Release
F55F8.4.1 Source_evidenceePCR564WS150 Sequence/Annotation Release
WB_DNA_textTH:79-e2690ccatgggaattctcgtcttctgataaaacttcctgcttgatatacttcgatctgtattccggagaactttccacttctcttttgatccttttcgatgatttttctgaaacatgaactggttgaaaaatcgagaaactaataactactctaagcgtttcgttaatatttgatatcaatgaacaagtgtttaggatcaaattaattatgtaaaaacctcatctttaaatacctttccaatcatcctcactatcgctgccatcagaatcgtcatcagtttcacgagatttgctcttcttatttttcttcttatctttcttcttgtctttattcttccgtttctctttcttttccttcttcttctcttttttactcttcttcttcattacatcttccaaatctgcaccgctcatcagcttcttatgcaatttctttttttccttttcagtcatcgaattgaaaaactccagcatcatttcttcttcggtcatttcttttttcattcttgttagctgttgatctgtctgcattccagccaaaacagaacttttgagtttgattccatgttcttcacgcatatcactcgcaagttgctgatgatccatccactcatcctcatcgtcatcttctcctgtcgccgcagcagcagacgatttcgatgttgaaggtcctgctttgccttcctgtcgtctc