Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:79-g10   

Cenix:79-g10RNAiCenix:79-g10
PCR_productcenix:79-g10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06A4.5 Source_evidenceePCR532WS150 Sequence/Annotation Release
Overlaps_Gene K06A4.5 Source_evidenceePCR532WS150 Sequence/Annotation Release
Chunk_score Abs_score427
Max_abs_score427K06A4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV95088509509567
Overlaps_transcriptK06A4.5 Source_evidenceePCR532WS150 Sequence/Annotation Release
WB_DNA_textTH:79-g10718cgttgaacgtgaacgaaagaatactgaatttgattgtgttcgatttcttgttggttcttccaatatcacactctttgaaagatggttctatttgactgatgttgtcaaggatttacctccattaatcaaagaattttatggatcgaatgaattcaaaactggttggtttgtagttgtgtgagctcaccgattttttgtttcaggtaaaccaggaaaaggaacatttgcatgcaatgctccatacgaagcaagatggactgatttacccgtacctattaatagaaaagaatttatctatgatcatatcagtgaagtgaagtaagaaattagttggttttgtttcggatagttaatttgagaagttttcagaaacggaccagtgagaatttatggagcacctgagtacaaaactgaagttatgttgctaggagagggatcttatgatttggaaagtggaactgtagagttgctaatttggttgcaggtatggcaaaaacagaaaaatcccaaaaaaaattcatgtatcatttaggaaaacacatttgcggtcgtagaagagagcgggttcacttatgcaatgaaatcggagaccatggttaggataaaaccgaacacaaagtaagaatacggaattataggttctttgaaataattttgttttaggtgtcttcttaatgtcaaaggaggatttgctatcaccatcagaatgccagcataa