Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:80-a9   

Cenix:80-a9RNAiCenix:80-a9
PCR_productcenix:80-a9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19B10.1 Source_evidenceePCR552WS150 Sequence/Annotation Release
Overlaps_Gene T19B10.1 Source_evidenceePCR584WS150 Sequence/Annotation Release
Chunk_score Abs_score542
Max_abs_score542T19B10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1122157111222537
Overlaps_transcriptT19B10.1 Source_evidenceePCR584WS150 Sequence/Annotation Release
WB_DNA_textTH:80-a9967tgggcttgttggaatttagctcataatccgaatgttcaagaaaaagtgtacaaagagatgattgaggtgtttggagatgatccaaatacagatattacactggaaaatgtgaataatctgaactatttggatatagttctcaaggaatcaaaacgaattatcgcaccagttcctgcacttcaaagaaaattaacaaatgatttagaaattggtaagttaaattctaaatgatgtggtttttaaaccaaaaatatcttgttaaaatcttaaagtattacaaacagttttatattaactttctgctgacttacatatgtctgaaaaaaacagaacatcaatccgcgtaagttcagtagaaaatgtgaattaacggcacttcagttaaattatcaattactattgtcaacattcaagtactccccaatttcagaaaagtttctgcataaaaaatctctgaaattaaggaaaataataaactatcaaaaaccaaatgttagaataaatgatttaatttgattattttcagatggatacatagttcccgctggtggcaatgtgacaatatctccaatggttcttcacagcaatcatcacgtgttcaaaaatccaacagaattcaatcctgacagatttcttccggatgaagtttcaaagagacatccgtatgattttatgcctttcttggctggtcctcgtaattgtattggccaaaagtttgcgcaactaaatgagaaagtaatgatttctcatattgttcgaaacttcaaaattgaaccaactctgaaatataatgacacaaaaccatgtctggaagtggtaacaaaaccatcgaatgggattccagttcgattaattcgcagaaactagagcatcgttcagttacctgtatattttcacatttttaaataaacgattttacctaaaaaccaattacttgtctctcaacaatcattgcccattccatcat