Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:81-b3   

Cenix:81-b3RNAiCenix:81-b3
PCR_productcenix:81-b3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY53C10A.4 Source_evidenceePCR696WS150 Sequence/Annotation Release
Overlaps_Gene Y53C10A.4 Source_evidenceePCR696WS150 Sequence/Annotation Release
Chunk_score Abs_score675
Max_abs_score675Y53C10A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1198232211983178
Overlaps_transcriptY53C10A.4 Source_evidenceePCR696WS150 Sequence/Annotation Release
WB_DNA_textTH:81-b3857gatcgatattcggcaaaggattaaatggtccaactccaccacaacccatcatgacaattgttgatcacctccgaatggatggttttgatgctgagggaatcttcagaaagtccccgaaacagagcacattcaaagagctcaaatgtgagctagacaaaggtgtggttccagacttccataagtacaacacacatgtcttggcgtcaattctcaaggaatatttgagaagtattcctggaaagattctgttatccggaaattatgagctatggatgagagagatcgctgacgagccgaacactgagaaaaaagtctcatgctgcagagctctgctatctcatcttccaacatctcatagcatcctgctagccaatgtgttaaagcttctgaacaagatctcaaattctccaagctccaaaatgaatgcttcatccttatcagtatgccttgctccgagctttctagagagcccagatccaatggaaggagggaagaagatcccaccgttgatagagttcttaatctcccacgcagctcaagtgatgcccggcttctccacagacaatgtatttgccatcatgacctccccaatggtagatcacaatgcgaatatggtgtgctcaccggcgccaagttcttctcattctgatgatggaggatcttcacagaaaacgccgattattgaggaattgaatggtaagtgcgggctagctgagaagttctgagccaagctatgactgtccgccagcggacaggtgctcagcaaaattatccgaaatattataaacttggtccagaccgcgccgaagcttgatcaaactcttgatctaggtaagacagtaccacaactgaggcga