Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:81-f1   

Cenix:81-f1RNAiCenix:81-f1
PCR_productcenix:81-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW02B9.1b Source_evidenceePCR506WS150 Sequence/Annotation Release
Overlaps_Gene W02B9.1 Source_evidenceePCR506WS150 Sequence/Annotation Release
Chunk_score Abs_score506
Max_abs_score506W02B9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1111461911115179
Overlaps_transcriptW02B9.1b Source_evidenceePCR506WS150 Sequence/Annotation Release
WB_DNA_textTH:81-f1561gtagccgtcccccagtttatgacccaaatctcgttttttttgtggtttccttacctgcacatctgcatatcccaccaatccattcccatcatcatcaatcgcctgaaccacaaaattccatgacggaactcctgccggaggatctctatccaacgccttgaccaactcaattgtccccgaatactttccaattcgaaacacttcatcagctccctgcccttcaagcctgtacactatcctactgctcttctcatcctgatcagcatccgtcgcgtgaacattgaacagaaccttcggaatatccacgtcctcctcgatgactgtagtcgcgtacttttgctgctcgaactgtggagcattgtcattaacatcctcgatgtgaatgtagacattggtggtagcgttgtggcgtccatcagaggcgataaggactaggtggtattgatcggaagcttcaaagtctaagggttccttgacgaatatggtaccggaatctgttcggacgccgaaggggatccgtccaccaccggctccgatgaggtgatagcggaggttggaatc